Molecular weight and extinction coefficients of synthetic oligonucleotides
- Calculate the molecular weight of DNA as follows:
| Mol. wt = |
[(251 x nA) + (242 x nT) + (267 x nG) + (227 x nC) + (63 x n - 1) +
(23 x n - 1) + 2]
|
nA = number of adenine bases in the DNA sequence and n = total number of bases.
(63 x n - 1) accounts for the molecular weight of the phosphate groups. For phosphorothioates this is (78 x n - 1)
(23 x n - 1) accounts for the sodium cations associated with the phosphate groups. If the DNA is an ammonium salt this is (17 x n - 1).
Example:
The 20mer d(AGCTCTGAACGTAGCTCTGA)
| Mol. wt = |
[(5 x 251) + (5 x 242) + (5 x 267) + (5 x 227) + (63 x 19) +
(23 x 19) + 2] = 6571 mg/mmol
|
- Calculation of millimolar extinction coefficient (E254):
E254 = [(8.8 x nT) + (7.3 x nC) + (11.7 x nG) + (15.4 x nA)] x 0.9*
For the 20mer d(AGCTCTGAACGTAGCTCTGA):
E254 = [(8.8 x 5) + (7.3 x 5) + (11.7 x 5) + (15.4 x 5)] x 0.9* = 194.4 mM-1cm-1
*Note that it is advisable to multiply the sum of the extinction coefficient of the individual bases by a factor of 0.9. This is because base stacking interactions in the single strand suppress the absorbance of DNA relative to the value calculated from the extinction coefficients of the individual nucleosides. This effect is greater for a duplex and the multiplication factor for a selfcomplementary sequence is c. 0.8. These figures are estimates for typical DNA sequences.
- To convert OD units to milligrams
From the above calculations, 6.6 mg of the oligonucleotide
d (AGCTCTGAACGTAG CTCTGA) dissolved in 1 ml will have an absorbance of approximately 194.4 OD units at 254 nm.
6.6 mg = 194.4 OD units. Therfore, 1 mg = 29 OD
| Protein/DNA conversion
1kb of DNA encodes 333 amino acids = 3.7 x 104 DA |
Molecular conversion for protein |
| Protein |
DNA |
100 pmol |
µg |
| 10,000 Da |
270.0 bp |
10,000 Da protein |
1 |
| 30,000 Da |
810.0 bp |
30,000 Da protein |
3 |
| 100,000 Da |
2.7 kb |
100,000 Da protein |
10 |
Melting temperature of duplex DNA and oligonucleotides
- For duplex oligonucleotide shorter than 25 bp
Tm = 2(A+T) + 4(C+G)
A, T, C, G - number of respective bases
- For duplex DNA longer than 25 bp
Tm = 81.5°C + (16.6log10[Na+])+0.41 x (G+C)%-600/n
n=length of oligonucleotide
The genetic code
Nucleotide ambiguity code
| Code |
Represents |
Complement |
| A |
A |
T |
| C |
C |
G |
| G |
G |
C |
| T |
T |
A |
| M |
A or C |
K |
| R |
A or G |
Y |
| W |
A or T |
W |
| S |
C or G |
S |
| Y |
C or T |
R |
| K |
G or T |
M |
| V |
A or C or G |
B |
| H |
A or C or T |
D |
| D |
A or G or T |
H |
| B |
C or G or T |
V |
| X/N |
A or C or G or T |
X/N |
|
|
not A, C, G or T |
- |
|
